Review



freestyle 293 atcc n a experimental models  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC freestyle 293 atcc n a experimental models
    Freestyle 293 Atcc N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 22346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/293/pm31390572-307-110-112
    Average 99 stars, based on 22346 article reviews
    freestyle 293 atcc n a experimental models - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Mutagenesis:

    Article Title: Mutations in the Heterotopia Gene Eml1/EML1 Severely Disrupt the Formation of Primary Cilia.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-g tubulin Sigma T6557; RRID: AB_477584 Rabbit anti-Arl13b Proteintech 17711-1-AP; RRID: 2060867 Mouse anti-GFP Sigma G6539; RRID: AB_259941 Rabbit anti-GFP Invitrogen A6455; RRID: AB_221570 Rabbit anti-Flag Sigma F7425, RRID: AB_439687 Mouse anti-Flag Sigma F1804; RRID: 262044 Mouse anti-c-myc Cell Signaling Technology 9B11; RRID: AB_10889248 Mouse anti-Strep Invitrogen GT661; RRID: AB_2538749 Chicken anti-GAPDH Millipore AB2302; RRID: AB_10615768 Goat anti-Gli3 R&D systems AF3690; AB_2232499 Alexa Fluor 633 Phalloidin Thermo Fisher A22284, N/A Sheep anti-TGN46 BioRad AHP500GT; RRID: AB_2203291 Mouse anti-GM130 BD Biosciences Cat#610822; RRID: AB_10015242 Mouse anti-Sox2 R&D systems MAB2018; RRID: AB_358009 Mouse anti-Pax6 Synaptic Systems Cat#153011; RRID: AB_887758 Rabbit anti-Otx2 TaKaRa M199, N/A Rabbit anti-Foxg1 TaKaRa M227, N/A Rabbit anti-Arl13b NeuroMab Cat#75-287; RRID: AB_2341543 Mouse anti-Ki67 BD Biosciences Cat#556003; RRID: AB_396287 Rat anti-BrdU BioRad MCA2060GA; RRID: AB_10545551 Chicken anti-GFP Millipore AB16901; RRID: 90890 Rabbit anti-Pax6 BioLegend Cat#901301; AB2565003 Goat anti-mouse Alexa 488 Thermo Fisher Cat#A28175; RRID: AB_2536161 Goat anti-rabbit Alexa 568 Thermo Fisher Cat#A-11011; RRID: AB_143157 Dylight anti-mouse 800 Thermo Fisher Cat#SA5-35521; RRID: AB_2556774 Dylight anti-rabbit 800 Thermo Fisher Cat#SA5-35571; RRID: AB_2556775 Dylight anti-chicken 680 Thermo Fisher Cat#SA5-10074; RRID: AB_2556654 Goat anti-mouse Alexa 568 Thermo Fisher Cat#A-11031; RRID: AB_144696 Donkey anti-goat Alexa 568 Thermo Fisher Cat#A-11057; RRID: AB_142581 Goat anti-rabbit Alexa 488 Thermo Fisher Cat#A-11008; RRID: AB_143165 Goat anti-mouse Alexa 555 Thermo Fisher Cat#A32727; RRID: AB_2633276 Goat anti-rat Alexa 568 Thermo Fisher Cat#A-11006; RRID: AB_141373 Donkey anti-rabbit Alexa 647 Thermo Fisher Cat#A-31573; RRID: AB_2536183 Bacterial and Virus Strains 5-alpha competent E. coli NEB Cat#2988J CytoTune-iPS 2.0 Sendai Reprogramming Kit Thermo Fisher A16517 Biological Samples Human fibroblasts Coriell Biorepository N/A Research center project SFB636 B7 Cell Bank Necker Hospital Cell Bank Cochin Hospital Erasmus Medial Center Cell Bank (Continued on next page) e1 Cell Reports 28, 1596–1611.e1–e10, August 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays QuikChange Lightning Site-Directed Mutagenesis kit Agilent Technologies Cat#210518 Lipofectamine 2000 Invitrogen Cat#11668030 Lipofectamine 3000 Invitrogen Cat#L3000001 Maxi prep kit Macherey-Nagel Cat#740410.10 NimbleGen chip 720,000-probes array Roche-NimbleGen N/A SureSelect Human All Exon Kit v5 Agilent Technologies N/A Micro BCA Protein Assay Kit ThermoFisher Cat#23235 Polyethylenimine Polysciences Cat#23966-1 Strep-Tactin beads Superflow Plus QIAGEN Cat#30002 RSLCnano system ThermoFisher Ultimate 3000 Epoxy resin PolySciences EPON218 3500xL Genetic Analyzer for Human Identification ThermoFisher Cat#4406016 NanoViper Acclaim PepMap 100 ThermoFisher N/A 5-bromo-20-deoxyuridine (BrdU) Sigma B9285 Deposited Data PRIDE: PXD012714 Perez-Riverol et al., 2019 https://www.ebi.ac.uk/pride/archive/ Experimental Models: Cell Lines Human: hTERT RPE1 ATCC N/A Mouse: Neuro2A ATCC N/A Human: FreeStyle 293 ATCC N/A Experimental Models: Organisms/Strains Mouse: HeCo NORCD1 Croquelois et al., 2009; Kielar et al., 2014 N/A Mouse: Swiss Janvier Labs N/A Oligonucleotides RPGRIP1L-ex24-R This paper 50 GCCTCCCAGGTATCTGGG 30 RPGRIP1L-ex22-F This paper 50CAGTAGTGTACATTGCATTC 30 RPGRIP1L-ex22-R This paper 50 TCTCTCTGTTCTTTCCACTTC 30 RPGRIP1L-ex24-F This paper 50 CTTAGAAAGTGGATTAGTGTTC 30 RM1_Vcpip1 KiCqStart, Sigma 50 GGAAAAGTACAATGTTTGCC 30 FW1_Vcpip1 KiCqStart, Sigma 50 GCTACATTAATGGGAGAAGAC 30 Recombinant DNA VSVts405-G-EGFP B. Goud lab N/A CMV-3xFlag-EML1 Kielar et al., 2014 N/A CMV-3xFlag-EML1 T243A Kielar et al., 2014 N/A pCAG-Galt-EGFP Kimura and Murakami, 2014 N/A pEGFP-C3-EML1 Kielar et al., 2014 N/A pEGFP-C3-EML1 T243A Kielar et al., 2014 N/A pCS2-c-myc-RPGRIP1L Delous et al., 2007 N/A pCS2-c-myc-RPGRIP1L R1236C This paper N/A pCS2-c-myc-RPGRIP1L V1188M This paper N/A CMV-3xFlag-VCIP135 Zhang and Wang, 2015 N/A pMAX-Strep-YFP-EML1 Richards et al., 2014 N/A pCAGMIR30-shRNA scramble This paper 50 TCCTAATTTCCGTGTGACAGT 30 pCAGMIR30-shRNA Vcip135 This paper 50 TTGTGCCTCAGGACCTTATTA 30 pMAX-Strep-YFP This paper N/A (Continued on next page) Cell Reports 28, 1596–1611.e1–e10, August 6, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGIG Kielar et al., 2014, Addgene N/A pCAG-Arl13b-RFP Jung et al., 2016 N/A pCAG-IRES-Tomato C. Lebrand lab N/A Software and Algorithms Prism GraphPad software N/A Tissue Analyzer Aigouy et al., 2010 https://imagej.nih.gov/ij/ Cell Profiler Cell Profiler, Lamprecht et al., 2007 https://cellprofiler.org/ Fiji/ImageJ Fiji/ImageJ https://fiji.sc/ Unified Genotyper GATK https://software.broadinstitute.org/gatk/ Polyweb University Paris Descartes N/A Imagine Institute Proteome discoverer version 2.1 ThermoFisher N/A MyProms Poullet et al., 2007 N/A MassChroQ version 1.2 Valot et al., 2011 N/A CRAPome Mellacheruvu et al., 2013 http://crapome.org/ Burrows Wheeler Aligner SourceForge https://sourceforge.net/projects/bio-bwa/files/ PolyPhen-2 PolyPhen-2 http://genetics.bwh.harvard.edu/pph2/ SIFT Sorting Intolerant From Tolerant https://sift.bii.a-star.edu.sg/

    Bicinchoninic Acid Protein Assay:

    Article Title: Mutations in the Heterotopia Gene Eml1/EML1 Severely Disrupt the Formation of Primary Cilia.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-g tubulin Sigma T6557; RRID: AB_477584 Rabbit anti-Arl13b Proteintech 17711-1-AP; RRID: 2060867 Mouse anti-GFP Sigma G6539; RRID: AB_259941 Rabbit anti-GFP Invitrogen A6455; RRID: AB_221570 Rabbit anti-Flag Sigma F7425, RRID: AB_439687 Mouse anti-Flag Sigma F1804; RRID: 262044 Mouse anti-c-myc Cell Signaling Technology 9B11; RRID: AB_10889248 Mouse anti-Strep Invitrogen GT661; RRID: AB_2538749 Chicken anti-GAPDH Millipore AB2302; RRID: AB_10615768 Goat anti-Gli3 R&D systems AF3690; AB_2232499 Alexa Fluor 633 Phalloidin Thermo Fisher A22284, N/A Sheep anti-TGN46 BioRad AHP500GT; RRID: AB_2203291 Mouse anti-GM130 BD Biosciences Cat#610822; RRID: AB_10015242 Mouse anti-Sox2 R&D systems MAB2018; RRID: AB_358009 Mouse anti-Pax6 Synaptic Systems Cat#153011; RRID: AB_887758 Rabbit anti-Otx2 TaKaRa M199, N/A Rabbit anti-Foxg1 TaKaRa M227, N/A Rabbit anti-Arl13b NeuroMab Cat#75-287; RRID: AB_2341543 Mouse anti-Ki67 BD Biosciences Cat#556003; RRID: AB_396287 Rat anti-BrdU BioRad MCA2060GA; RRID: AB_10545551 Chicken anti-GFP Millipore AB16901; RRID: 90890 Rabbit anti-Pax6 BioLegend Cat#901301; AB2565003 Goat anti-mouse Alexa 488 Thermo Fisher Cat#A28175; RRID: AB_2536161 Goat anti-rabbit Alexa 568 Thermo Fisher Cat#A-11011; RRID: AB_143157 Dylight anti-mouse 800 Thermo Fisher Cat#SA5-35521; RRID: AB_2556774 Dylight anti-rabbit 800 Thermo Fisher Cat#SA5-35571; RRID: AB_2556775 Dylight anti-chicken 680 Thermo Fisher Cat#SA5-10074; RRID: AB_2556654 Goat anti-mouse Alexa 568 Thermo Fisher Cat#A-11031; RRID: AB_144696 Donkey anti-goat Alexa 568 Thermo Fisher Cat#A-11057; RRID: AB_142581 Goat anti-rabbit Alexa 488 Thermo Fisher Cat#A-11008; RRID: AB_143165 Goat anti-mouse Alexa 555 Thermo Fisher Cat#A32727; RRID: AB_2633276 Goat anti-rat Alexa 568 Thermo Fisher Cat#A-11006; RRID: AB_141373 Donkey anti-rabbit Alexa 647 Thermo Fisher Cat#A-31573; RRID: AB_2536183 Bacterial and Virus Strains 5-alpha competent E. coli NEB Cat#2988J CytoTune-iPS 2.0 Sendai Reprogramming Kit Thermo Fisher A16517 Biological Samples Human fibroblasts Coriell Biorepository N/A Research center project SFB636 B7 Cell Bank Necker Hospital Cell Bank Cochin Hospital Erasmus Medial Center Cell Bank (Continued on next page) e1 Cell Reports 28, 1596–1611.e1–e10, August 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays QuikChange Lightning Site-Directed Mutagenesis kit Agilent Technologies Cat#210518 Lipofectamine 2000 Invitrogen Cat#11668030 Lipofectamine 3000 Invitrogen Cat#L3000001 Maxi prep kit Macherey-Nagel Cat#740410.10 NimbleGen chip 720,000-probes array Roche-NimbleGen N/A SureSelect Human All Exon Kit v5 Agilent Technologies N/A Micro BCA Protein Assay Kit ThermoFisher Cat#23235 Polyethylenimine Polysciences Cat#23966-1 Strep-Tactin beads Superflow Plus QIAGEN Cat#30002 RSLCnano system ThermoFisher Ultimate 3000 Epoxy resin PolySciences EPON218 3500xL Genetic Analyzer for Human Identification ThermoFisher Cat#4406016 NanoViper Acclaim PepMap 100 ThermoFisher N/A 5-bromo-20-deoxyuridine (BrdU) Sigma B9285 Deposited Data PRIDE: PXD012714 Perez-Riverol et al., 2019 https://www.ebi.ac.uk/pride/archive/ Experimental Models: Cell Lines Human: hTERT RPE1 ATCC N/A Mouse: Neuro2A ATCC N/A Human: FreeStyle 293 ATCC N/A Experimental Models: Organisms/Strains Mouse: HeCo NORCD1 Croquelois et al., 2009; Kielar et al., 2014 N/A Mouse: Swiss Janvier Labs N/A Oligonucleotides RPGRIP1L-ex24-R This paper 50 GCCTCCCAGGTATCTGGG 30 RPGRIP1L-ex22-F This paper 50CAGTAGTGTACATTGCATTC 30 RPGRIP1L-ex22-R This paper 50 TCTCTCTGTTCTTTCCACTTC 30 RPGRIP1L-ex24-F This paper 50 CTTAGAAAGTGGATTAGTGTTC 30 RM1_Vcpip1 KiCqStart, Sigma 50 GGAAAAGTACAATGTTTGCC 30 FW1_Vcpip1 KiCqStart, Sigma 50 GCTACATTAATGGGAGAAGAC 30 Recombinant DNA VSVts405-G-EGFP B. Goud lab N/A CMV-3xFlag-EML1 Kielar et al., 2014 N/A CMV-3xFlag-EML1 T243A Kielar et al., 2014 N/A pCAG-Galt-EGFP Kimura and Murakami, 2014 N/A pEGFP-C3-EML1 Kielar et al., 2014 N/A pEGFP-C3-EML1 T243A Kielar et al., 2014 N/A pCS2-c-myc-RPGRIP1L Delous et al., 2007 N/A pCS2-c-myc-RPGRIP1L R1236C This paper N/A pCS2-c-myc-RPGRIP1L V1188M This paper N/A CMV-3xFlag-VCIP135 Zhang and Wang, 2015 N/A pMAX-Strep-YFP-EML1 Richards et al., 2014 N/A pCAGMIR30-shRNA scramble This paper 50 TCCTAATTTCCGTGTGACAGT 30 pCAGMIR30-shRNA Vcip135 This paper 50 TTGTGCCTCAGGACCTTATTA 30 pMAX-Strep-YFP This paper N/A (Continued on next page) Cell Reports 28, 1596–1611.e1–e10, August 6, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGIG Kielar et al., 2014, Addgene N/A pCAG-Arl13b-RFP Jung et al., 2016 N/A pCAG-IRES-Tomato C. Lebrand lab N/A Software and Algorithms Prism GraphPad software N/A Tissue Analyzer Aigouy et al., 2010 https://imagej.nih.gov/ij/ Cell Profiler Cell Profiler, Lamprecht et al., 2007 https://cellprofiler.org/ Fiji/ImageJ Fiji/ImageJ https://fiji.sc/ Unified Genotyper GATK https://software.broadinstitute.org/gatk/ Polyweb University Paris Descartes N/A Imagine Institute Proteome discoverer version 2.1 ThermoFisher N/A MyProms Poullet et al., 2007 N/A MassChroQ version 1.2 Valot et al., 2011 N/A CRAPome Mellacheruvu et al., 2013 http://crapome.org/ Burrows Wheeler Aligner SourceForge https://sourceforge.net/projects/bio-bwa/files/ PolyPhen-2 PolyPhen-2 http://genetics.bwh.harvard.edu/pph2/ SIFT Sorting Intolerant From Tolerant https://sift.bii.a-star.edu.sg/

    Recombinant:

    Article Title: Mutations in the Heterotopia Gene Eml1/EML1 Severely Disrupt the Formation of Primary Cilia.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse anti-g tubulin Sigma T6557; RRID: AB_477584 Rabbit anti-Arl13b Proteintech 17711-1-AP; RRID: 2060867 Mouse anti-GFP Sigma G6539; RRID: AB_259941 Rabbit anti-GFP Invitrogen A6455; RRID: AB_221570 Rabbit anti-Flag Sigma F7425, RRID: AB_439687 Mouse anti-Flag Sigma F1804; RRID: 262044 Mouse anti-c-myc Cell Signaling Technology 9B11; RRID: AB_10889248 Mouse anti-Strep Invitrogen GT661; RRID: AB_2538749 Chicken anti-GAPDH Millipore AB2302; RRID: AB_10615768 Goat anti-Gli3 R&D systems AF3690; AB_2232499 Alexa Fluor 633 Phalloidin Thermo Fisher A22284, N/A Sheep anti-TGN46 BioRad AHP500GT; RRID: AB_2203291 Mouse anti-GM130 BD Biosciences Cat#610822; RRID: AB_10015242 Mouse anti-Sox2 R&D systems MAB2018; RRID: AB_358009 Mouse anti-Pax6 Synaptic Systems Cat#153011; RRID: AB_887758 Rabbit anti-Otx2 TaKaRa M199, N/A Rabbit anti-Foxg1 TaKaRa M227, N/A Rabbit anti-Arl13b NeuroMab Cat#75-287; RRID: AB_2341543 Mouse anti-Ki67 BD Biosciences Cat#556003; RRID: AB_396287 Rat anti-BrdU BioRad MCA2060GA; RRID: AB_10545551 Chicken anti-GFP Millipore AB16901; RRID: 90890 Rabbit anti-Pax6 BioLegend Cat#901301; AB2565003 Goat anti-mouse Alexa 488 Thermo Fisher Cat#A28175; RRID: AB_2536161 Goat anti-rabbit Alexa 568 Thermo Fisher Cat#A-11011; RRID: AB_143157 Dylight anti-mouse 800 Thermo Fisher Cat#SA5-35521; RRID: AB_2556774 Dylight anti-rabbit 800 Thermo Fisher Cat#SA5-35571; RRID: AB_2556775 Dylight anti-chicken 680 Thermo Fisher Cat#SA5-10074; RRID: AB_2556654 Goat anti-mouse Alexa 568 Thermo Fisher Cat#A-11031; RRID: AB_144696 Donkey anti-goat Alexa 568 Thermo Fisher Cat#A-11057; RRID: AB_142581 Goat anti-rabbit Alexa 488 Thermo Fisher Cat#A-11008; RRID: AB_143165 Goat anti-mouse Alexa 555 Thermo Fisher Cat#A32727; RRID: AB_2633276 Goat anti-rat Alexa 568 Thermo Fisher Cat#A-11006; RRID: AB_141373 Donkey anti-rabbit Alexa 647 Thermo Fisher Cat#A-31573; RRID: AB_2536183 Bacterial and Virus Strains 5-alpha competent E. coli NEB Cat#2988J CytoTune-iPS 2.0 Sendai Reprogramming Kit Thermo Fisher A16517 Biological Samples Human fibroblasts Coriell Biorepository N/A Research center project SFB636 B7 Cell Bank Necker Hospital Cell Bank Cochin Hospital Erasmus Medial Center Cell Bank (Continued on next page) e1 Cell Reports 28, 1596–1611.e1–e10, August 6, 2019 .. REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays QuikChange Lightning Site-Directed Mutagenesis kit Agilent Technologies Cat#210518 Lipofectamine 2000 Invitrogen Cat#11668030 Lipofectamine 3000 Invitrogen Cat#L3000001 Maxi prep kit Macherey-Nagel Cat#740410.10 NimbleGen chip 720,000-probes array Roche-NimbleGen N/A SureSelect Human All Exon Kit v5 Agilent Technologies N/A Micro BCA Protein Assay Kit ThermoFisher Cat#23235 Polyethylenimine Polysciences Cat#23966-1 Strep-Tactin beads Superflow Plus QIAGEN Cat#30002 RSLCnano system ThermoFisher Ultimate 3000 Epoxy resin PolySciences EPON218 3500xL Genetic Analyzer for Human Identification ThermoFisher Cat#4406016 NanoViper Acclaim PepMap 100 ThermoFisher N/A 5-bromo-20-deoxyuridine (BrdU) Sigma B9285 Deposited Data PRIDE: PXD012714 Perez-Riverol et al., 2019 https://www.ebi.ac.uk/pride/archive/ Experimental Models: Cell Lines Human: hTERT RPE1 ATCC N/A Mouse: Neuro2A ATCC N/A Human: FreeStyle 293 ATCC N/A Experimental Models: Organisms/Strains Mouse: HeCo NORCD1 Croquelois et al., 2009; Kielar et al., 2014 N/A Mouse: Swiss Janvier Labs N/A Oligonucleotides RPGRIP1L-ex24-R This paper 50 GCCTCCCAGGTATCTGGG 30 RPGRIP1L-ex22-F This paper 50CAGTAGTGTACATTGCATTC 30 RPGRIP1L-ex22-R This paper 50 TCTCTCTGTTCTTTCCACTTC 30 RPGRIP1L-ex24-F This paper 50 CTTAGAAAGTGGATTAGTGTTC 30 RM1_Vcpip1 KiCqStart, Sigma 50 GGAAAAGTACAATGTTTGCC 30 FW1_Vcpip1 KiCqStart, Sigma 50 GCTACATTAATGGGAGAAGAC 30 Recombinant DNA VSVts405-G-EGFP B. Goud lab N/A CMV-3xFlag-EML1 Kielar et al., 2014 N/A CMV-3xFlag-EML1 T243A Kielar et al., 2014 N/A pCAG-Galt-EGFP Kimura and Murakami, 2014 N/A pEGFP-C3-EML1 Kielar et al., 2014 N/A pEGFP-C3-EML1 T243A Kielar et al., 2014 N/A pCS2-c-myc-RPGRIP1L Delous et al., 2007 N/A pCS2-c-myc-RPGRIP1L R1236C This paper N/A pCS2-c-myc-RPGRIP1L V1188M This paper N/A CMV-3xFlag-VCIP135 Zhang and Wang, 2015 N/A pMAX-Strep-YFP-EML1 Richards et al., 2014 N/A pCAGMIR30-shRNA scramble This paper 50 TCCTAATTTCCGTGTGACAGT 30 pCAGMIR30-shRNA Vcip135 This paper 50 TTGTGCCTCAGGACCTTATTA 30 pMAX-Strep-YFP This paper N/A (Continued on next page) Cell Reports 28, 1596–1611.e1–e10, August 6, 2019 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pCAGIG Kielar et al., 2014, Addgene N/A pCAG-Arl13b-RFP Jung et al., 2016 N/A pCAG-IRES-Tomato C. Lebrand lab N/A Software and Algorithms Prism GraphPad software N/A Tissue Analyzer Aigouy et al., 2010 https://imagej.nih.gov/ij/ Cell Profiler Cell Profiler, Lamprecht et al., 2007 https://cellprofiler.org/ Fiji/ImageJ Fiji/ImageJ https://fiji.sc/ Unified Genotyper GATK https://software.broadinstitute.org/gatk/ Polyweb University Paris Descartes N/A Imagine Institute Proteome discoverer version 2.1 ThermoFisher N/A MyProms Poullet et al., 2007 N/A MassChroQ version 1.2 Valot et al., 2011 N/A CRAPome Mellacheruvu et al., 2013 http://crapome.org/ Burrows Wheeler Aligner SourceForge https://sourceforge.net/projects/bio-bwa/files/ PolyPhen-2 PolyPhen-2 http://genetics.bwh.harvard.edu/pph2/ SIFT Sorting Intolerant From Tolerant https://sift.bii.a-star.edu.sg/



    Similar Products

    freestyle 293 atcc n a experimental models  (ATCC)
    99
    ATCC freestyle 293 atcc n a experimental models
    Freestyle 293 Atcc N A Experimental Models, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/freestyle+293+atcc+n+a+experimental+models/293/pm31390572-307-110-112
    Average 99 stars, based on 1 article reviews
    freestyle 293 atcc n a experimental models - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results